queenesmelynn2 queenesmelynn2
  • 04-04-2018
  • Arts
contestada

In the Classical period, _____ music was no longer dominant.

Respuesta :

jenhe
jenhe jenhe
  • 04-04-2018
I think religious or spiritual type songs.

Classical music was a big shift, even in the "New World" and people in the new worlds had a lot of different religions and gospels, and there are many recorded songs before classical music, before 1775, and these were the songs, mainly, so they weren't dominant.
Answer Link

Otras preguntas

does a human body use neon???
where are the three parts of an atom located
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
Why did the American public mostly oppose joining the League of Nations after WWI?
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Help pl0x, Algebra 1
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
what is 15/24 in simplest form
Which word has the long i sound? relieve speciality society social