mercedes130625ovmmvv mercedes130625ovmmvv

02-09-2017
Mathematics

contestada

A newspaper charges $4 per line for the first 4 lines plus a $20 fee to advertise

Respuesta :

Melia0813 Melia0813

02-09-2017

So what's the question

Answer Link

izzzzzzzNat izzzzzzzNat

02-09-2017

Well you have to divide 20 and 4 and the answer is 5 because it cost 5 dollars

Answer Link

Otras preguntas

I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou

Two factors that determine whether a reaction will occur spontaneously

who invented the glass harmonica

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Can someone please help me with numbers 1, a, b, c, 2, a, b, c

Thinking about suicide is called _________, and a suicide attempt that is not completed is called __________.

Caleb solved this equation and recorded his work. 7.4x + 4.1(2x − 4) = −2.3(x − 6) − 21.6 1. 7.4x + 8.2x − 16.4 = −2.3x + 13.8 − 21.6 2. 15.6x − 16.4 = −2.3x

Identify the vertical asymptote(s) of each function. Check all of the boxes that apply. f(x)=3x/x^2-16 Answers: x = -16 x = -4 x = 0 x = 4 x = 16

Biggest reason why the united states did not want to enter world war 1

what is the smallest unit that can evolve