buster233
buster233 buster233
  • 04-05-2017
  • Mathematics
contestada

i need help can some plz help

i need help can some plz help class=

Respuesta :

tman225
tman225 tman225
  • 06-05-2017
replace the x and y and the answer would be A
Answer Link

Otras preguntas

Social disparity was one of the major causes of french revolution. Justify the statement
The "aha!" moment demonstrated by wolfgang kohler's work with chimpanzees demonstrates:
the height h in feet of a projectile launched upward at a speed of 32 feet/ second from a height of 48 feet is given by the function : h(t) =16^2+32t +48. how l
Attorney general a. mitchell palmer believed that he needed to protect the american people from
_______________ exposure to radiation can increase the risk of cancer.
A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?
Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The long-reigning absolutist king of france, __________, portrayed himself as the "sun king."
If an employee gets potentially infectious material splashed in his eye, what should he do?