xXScreamKittiXx xXScreamKittiXx

03-03-2017
Computers and Technology

contestada

Why is Linux widespread in academic environments? A. It is free. B. It is easily customizable. C. It does not have a graphical user interface. D. It is free and it is easily customizable.

Respuesta :

INeedAUsernameDangit INeedAUsernameDangit

03-03-2017

D. Linux is free and highly customizable.

Answer Link

brenda2140090 brenda2140090

24-04-2019

Answer:d it is free and it is easily customizable

Explanation:

Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

(3x + 3) (2x − 2) Please help me

Which is a key element found in all carbohydrates lipids proteins and nucleic acids

helpppp!!! i really need help asap

Climate Change can sometimes be good for a society. True False

One's intelligence quotient, or IQ, varies directly as a person's mental age and inversely as that person's chronological age. A person with a mental age of 22

please help asap....

Y is directly proportional to c when y= 30 and x= 6. A) work out an equation connecting y and x. B) work out the value of y when x= 12.

what do the structure do in the stomach animal.

Solve for h. h - 45 = -35