Lemaymaimsth6iBu Lemaymaimsth6iBu
  • 04-02-2017
  • Biology
contestada

What part of the brain controls emotions?

Respuesta :

Bioguy
Bioguy Bioguy
  • 04-02-2017
Emotions , like fear and love, are carried out by the limbic system, which is located in the temporal lobe. The center of emotional processing is the amygdala, which receives input from other brain functions, like memory and attention.
Answer Link

Otras preguntas

Step by step directions Square root for 480
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
how do i find the angles on a kite?
what is 15/24 in simplest form
The section of the small intestine between the duodenum and ilium?
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers