lillieclairesonnier lillieclairesonnier

04-01-2022
Mathematics

contestada

One number is eight less than a second number. Six times the first is 3 more than 3 times the second. Find the numbers.

Respuesta :

devil0184 devil0184

04-01-2022

This is the answer to your question

Ver imagen devil0184

Answer Link

Otras preguntas

I WILL MARK BRAINIEST AND GIVE 50 POINTS 4. Analyze what would happen to this ecosystem if one of the primary consumers was removed from the ecosystem? What wou

How many natural numbers less than 300 are either multiples of 2 or multiples of 3?

Find the least common multiple of the pair of polynomials. 2y^2-32 and y+4

The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti

For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)

PLEASE HELP ASAP find the quotient of -12x^3 + 21x^2 - 6x/ -3x.-4x^2 - 7x + 184x^2 + 7x + 18-12x^3 + 21x^2 + 24x^2 - 7x + 2

N the world's lowest-income nations, two in ten children born die by the age of

Which of the following is a monomial A. 12c B. C^2 -16 C. c^2+c+6 D. C^3 +4c^2 -12c + 7