friends1969 friends1969
  • 04-08-2021
  • Mathematics
contestada

If 400 g of chocolate sells for $12,
"how much is the cost per kilogram?

Respuesta :

btute
btute btute
  • 04-08-2021

the cost of the chocolate of 1 kg will be 30$

Answer Link

Otras preguntas

when Jefferson took office he did what
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Which body tissue or organ contains the most mitochondria?
a summary about concussions
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
Do you think then solid can undergo convection
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w