capreeson707 capreeson707

04-05-2021
Mathematics

contestada

how do you solve y= 2x + 3 by using a table of solutions and then graphing?

Respuesta :

zabroyal24 zabroyal24

04-05-2021

Answer:

1. Create a table that has a column for x and a column for y.

2. Plugin values for x and solve for y using the equation.

X | Y

-2 | -1

-1 | 1

0 | 3

1 | 5

2 | 7

3. Plot these values on a coordinate plane to graph them.

Ver imagen zabroyal24

Answer Link

Otras preguntas

The bretton woods system ended in select one: a. 1945. b. 1973. c. 1981. d. 2001.

What is the end behavior of the function f(x) = −x3 + 2x2 + 4x + 5? A. Up on the left, up on the right. B. Up on the left, down on the right. C. Down on the lef

The oxygen moves into the blood system from the lungs by the process. A.Exhalation B.Osmosis C.Diffusion D.Respiration

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the solution to the equation ? n = −1 n = 2 n = 5/3 n = 5/2

If 2/3 + 6 = 7/6p, what is the value of p?

How would you describe neville chamberlain's policy toward hitler in the late 1930?

Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.

The tendency for people to become more extreme in their attitudes as a result of group discussion is called _______.

A 12-foot ladder leans against the side of a house with its base 3 feet from the house. use the pythagorean theorem to approximate how high the ladder reaches u