toopthanoscar toopthanoscar
  • 03-05-2021
  • SAT
contestada

whats the dog doing in the bathroom

Respuesta :

4901636
4901636 4901636
  • 03-05-2021

Answer:

my guy i actually dont know?!

Explanation:

Answer Link
isabellaokeeffee isabellaokeeffee
  • 03-05-2021
i don't know sorry :(((((((
Answer Link

Otras preguntas

(8n+1)(6n-3) please solve in quadratic formula
Please help ASAP!!!! 100 points!
Name all of the traits that the mackerel has, based on this cladogram.
Los deportistas profesionales ____ el pago por si desempeño. recibe reciben reciban reciba
The term used when an organism is studied in its natural environment is
The culture of children strongly approves of children tattling on one and other. a. True b. False
Kalina is choosing a sandwich and a drink for lunch. She can choose between turkey, ham, and vegetarian sandwiches. She chooses her drink from a selection of wa
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A guaranteed protection against vague laws is known as which of the following?
Describe the set of data {33, 35, 38, 44, 45, 45, 46, 46, 46, 47}. a. normal distribution c. cannot be determined b. negatively skewed d. positively skewed