jaylaclemmons jaylaclemmons

03-04-2021
Physics

contestada

An object of mass 25 kg acted upon by a net force of 10 N will experience an acceleration of?

Respuesta :

sarah200408 sarah200408

04-04-2021

Answer:

0.4 m/s2

Explanation:

mass: 25kg

net force: 10 N

acceleration: ?

net force ÷ by mass= acceleration

10 N ÷ 25 Kg = 0.4 m/s2

Answer Link

Otras preguntas

An aqueous solution is tested with an electrical conductivity probe.The conductivity probe does not detect an electric current . Which solution was most likely

The human ear is sometimes called a Fourier analyzer. What does this mean and why is it an apt description? 1. Our ears can sort out the individual sine waves f

How do I write the mathematical expression for this question? "The value of a certain rare silver dollar was $60,000 in 1980. A price history of the silver doll

How do I write the mathematical expression for this question? "The value of a certain rare silver dollar was $60,000 in 1980. A price history of the silver doll

Clownfish, a small tropical fish found in the midst of sea anemones, are often not stung. What type of relationship might the clownfish have with the sea anemon

A beverage company wants to determine if people in the United States like their new logo. Which choice BEST represents the population? Every person in the Unite

Text-Dependent Questions Directions: For the following questions, choose the best answer or respond in complete sentences 1. PART A What does the word "stalwart

Which value represents the interquartile range (IQR)? A) 50 B) 110 C) 160 D) 560

calculate the shaded area circle a radius=6.5 circle b radius 2.3

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA