Seudónimo Seudónimo
  • 01-04-2021
  • Biology
contestada

What's Transpiration ?​

Respuesta :

Аноним Аноним
  • 01-04-2021

Explanation:

Transpiration is the process of water movement through a plant and its evaporation from aerial parts, such as leaves, stems and flowers.it helps in photosynthesis.

Answer Link

Otras preguntas

Which tortoises, mainland or island, need to eat more food per gram of their body mass?
Please help!!!! URGENT!!!!!!!!!!!!!!!!!!!!!
The _______ was Franklin Roosevelt's program designed to fight the Great Depression
NEED HELP ASAPPPPPPP
What’s the missing side?
if you work in an adolescent oncology youth cancer office will the doctor more likely see patients with Hodgkin lymphoma or neuroblastoma explain your answer
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
There is no universally agreed-upon definition of cultural competence.
Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month
Can I get some help with these questions thank you