treston3178 treston3178
  • 02-02-2021
  • Chemistry
contestada

A Sedentary lifestyle is a way of life that includes a lot of physical activity true or false?

Respuesta :

tatumbee123
tatumbee123 tatumbee123
  • 02-02-2021
2h-7 I had that before unless I’m tripping but I did rechecked
Answer Link

Otras preguntas

COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
What does hemostasis mean?
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
What does hemostasis mean?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right