Itsjoshgacha Itsjoshgacha

01-04-2020
Mathematics

contestada

Plz ANWSER find the area and round it to two decimal places

Plz ANWSER find the area and round it to two decimal places class=

Respuesta :

rufozulieth rufozulieth

02-04-2020

Answer:

4=20.16, 5=129.96, 6=52.2

Step-by-step explanation:

Ver imagen rufozulieth

Ver imagen rufozulieth

Ver imagen rufozulieth

Answer Link

Otras preguntas

If 2/3 + 6 = 7/6p, what is the value of p?

PLEASE HELP ASAPPPPPP An advertiser rents a rectangular billboard that is 44 ft wide and 20 ft tall. The rent is $15 per square foot. For a billboard twice as t

If f(x) = x2 – 25 and g(x) = x – 5, what is the domain of mc006-1.jpg?

Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

You draw two cards from a standard deck of 52 cards, but before you draw the second card, you put the first one back and reshuffle the deck. (a) are the outcome

Can I get some help with these questions thank you

If XY=18, YZ=14, and XZ=20, find the radius of each circle.

(60) Points HeLp asap 5 questions

WILL MARK THE BRAINIEST!!!!! A biologist just found a new organism living in the deep ocean and is unsure whether or not to classify it as an animal. Describe t